Regulon of HrcA in Roseburia intestinalis L1-82

Properties
Regulator type:	Transcription factor
TF locus tag:	ROSINTL182_03539
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -157 Score: 7.2 Sequence: TTAGCACTCACCTCTTGACAGTGCTAA Locus tag: ROSINTL182_02758 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	ROSINTL182_02758	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -78 Score: 7.4 Sequence: TTAGCACTCAAAAGAAATGAGTGCTAA Locus tag: ROSINTL182_02484 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: ROSINTL182_02483 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL Locus tag: ROSINTL182_02482 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	ROSINTL182_02484	groES	Heat shock protein 60 family co-chaperone GroES
	ROSINTL182_02483	groEL	Heat shock protein 60 family chaperone GroEL
	ROSINTL182_02482	groEL	Heat shock protein 60 family chaperone GroEL
Position: -132 Score: 7.1 Sequence: TTAGCACTCATTAAAAAAGAGTGCTGA Locus tag: ROSINTL182_03168 Name: htpG Funciton: Heat shock chaperone protein 90
	ROSINTL182_03168	htpG	Heat shock chaperone protein 90
Position: -180 Score: 6.8 Sequence: TTAGCACTCACCTCTTGACAGCGCTAA Locus tag: ROSINTL182_00166 Name: hsp20 Funciton: Heat shock protein Hsp20
	ROSINTL182_00166	hsp20	Heat shock protein Hsp20
Position: -58 Score: 7.3 Sequence: TTAGCACTCCACAATAATGAGTGCTAA Locus tag: ROSINTL182_03539 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: ROSINTL182_03540 Name: grpE Funciton: Heat shock protein GrpE
	ROSINTL182_03539	hrcA	heat-inducible transcription repressor HrcA
	ROSINTL182_03540	grpE	Heat shock protein GrpE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD