Regulon of HrcA in Eubacterium rectale ATCC 33656

Properties
Regulator type:	Transcription factor
TF locus tag:	EUBREC_1909
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	16
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 7.2 Sequence: TTAGCACTCTCACTTGACGAGTGCTAA Locus tag: EUBREC_2562 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	EUBREC_2562	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -20 Score: 7.3 Sequence: TTAGCACTCGAAAGAAATGAGTGCTAA Locus tag: EUBREC_2271 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: EUBREC_2270 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	EUBREC_2271	groES	Heat shock protein 60 family co-chaperone GroES
	EUBREC_2270	groEL	Heat shock protein 60 family chaperone GroEL
Position: -400 Score: 7.5 Sequence: TTAGCACTCACTATTTTTGAGTGCTAA Locus tag: EUBREC_1574 Name: null Funciton: hypothetical protein Locus tag: EUBREC_1573 Name: htpG Funciton: Heat shock chaperone protein 90
	EUBREC_1574		hypothetical protein
	EUBREC_1573	htpG	Heat shock chaperone protein 90
Position: -109 Score: 7.3 Sequence: TTAGCACTCGCTATTGACGAGTGCTAA Locus tag: EUBREC_2855 Name: hsp20 Funciton: Heat shock protein Hsp20 Locus tag: EUBREC_2854 Name: dnaJ2 Funciton: Chaperone protein DnaJ
	EUBREC_2855	hsp20	Heat shock protein Hsp20
	EUBREC_2854	dnaJ2	Chaperone protein DnaJ
Position: -204 Score: 7.3 Sequence: TTAGCACTCGCTATTGACGAGTGCTAA Locus tag: EUBREC_3351 Name: hsp20 Funciton: Heat shock protein Hsp20
	EUBREC_3351	hsp20	Heat shock protein Hsp20
Position: -157 Score: 7.3 Sequence: TTAGCACTCGCTATTGACGAGTGCTAA Locus tag: EUBREC_3358 Name: hsp20 Funciton: Heat shock protein Hsp20
	EUBREC_3358	hsp20	Heat shock protein Hsp20
Position: -157 Score: 7.4 Sequence: TTAGCACTCTCTATTGACGAGTGCTAA Locus tag: EUBREC_3394 Name: hsp20 Funciton: Heat shock protein Hsp20
	EUBREC_3394	hsp20	Heat shock protein Hsp20
Position: -123 Score: 6.2 Sequence: TTAGCACTCGAGGGTTGACATTGCTAA Position: -64 Score: 7.1 Sequence: TTAGCACTCCAAAATACAGAGTGCTAA Locus tag: EUBREC_1909 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: EUBREC_1908 Name: grpE Funciton: Heat shock protein GrpE Locus tag: EUBREC_1907 Name: null Funciton: hypothetical protein Locus tag: EUBREC_1906 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: EUBREC_1905 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: EUBREC_1904 Name: dnaJ Funciton: Chaperone protein DnaJ
	EUBREC_1909	hrcA	heat-inducible transcription repressor HrcA
	EUBREC_1908	grpE	Heat shock protein GrpE
	EUBREC_1907		hypothetical protein
	EUBREC_1906	dnaK	Chaperone protein DnaK
	EUBREC_1905	dnaJ	Chaperone protein DnaJ
	EUBREC_1904	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of HrcA in Eubacterium rectale ATCC 33656

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --