Regulon of HrcA in Dorea longicatena DSM 13814

Properties
Regulator type:	Transcription factor
TF locus tag:	DORLON_01874
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	13
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.5 Sequence: TTAGCACTCGGGGGTTGACAGTGCTAA Locus tag: DORLON_02511 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	DORLON_02511	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -184 Score: 7.3 Sequence: TTAGCACTCACCTCTAGACAGTGCTAA Locus tag: DORLON_02510 Name: hsp20 Funciton: Heat shock protein Hsp20
	DORLON_02510	hsp20	Heat shock protein Hsp20
Position: -207 Score: 7.3 Sequence: TTAGCACTCACCTATTGACAGTGCTAA Locus tag: DORLON_02781 Name: hsp20 Funciton: Heat shock protein Hsp20 Locus tag: DORLON_02780 Name: dnaJ2 Funciton: Chaperone protein DnaJ
	DORLON_02781	hsp20	Heat shock protein Hsp20
	DORLON_02780	dnaJ2	Chaperone protein DnaJ
Position: -163 Score: 7.4 Sequence: TTAGCACTCACTATTGACGAGTGCTAA Locus tag: DORLON_00596 Name: hsp20 Funciton: Heat shock protein Hsp20 Locus tag: DORLON_00595 Name: hsp20 Funciton: Heat shock protein Hsp20
	DORLON_00596	hsp20	Heat shock protein Hsp20
	DORLON_00595	hsp20	Heat shock protein Hsp20
Position: -383 Score: 7 Sequence: TCAGCACTCTCTTTTGTTGAGTGCTAA Locus tag: DORLON_01663 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	DORLON_01663	groEL	Heat shock protein 60 family chaperone GroEL
Position: -59 Score: 7 Sequence: TCAGCACTCTCTTTTGTTGAGTGCTAA Locus tag: DORLON_01664 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES
	DORLON_01664	groES	Heat shock protein 60 family co-chaperone GroES
Position: -171 Score: 7.4 Sequence: TTAGCACTCTTTTTAAAAGAGTGCTAA Locus tag: DORLON_02814 Name: htpG Funciton: Heat shock chaperone protein 90
	DORLON_02814	htpG	Heat shock chaperone protein 90
Position: -74 Score: 7.2 Sequence: TTAGCACTCAGATAAAAAGAGTGCTAA Locus tag: DORLON_01874 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: DORLON_01873 Name: grpE Funciton: Heat shock protein GrpE Locus tag: DORLON_01872 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: DORLON_01871 Name: dnaJ Funciton: Chaperone protein DnaJ
	DORLON_01874	hrcA	heat-inducible transcription repressor HrcA
	DORLON_01873	grpE	Heat shock protein GrpE
	DORLON_01872	dnaK	Chaperone protein DnaK
	DORLON_01871	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of HrcA in Dorea longicatena DSM 13814

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --