Regulon of HrcA in Dorea formicigenerans ATCC 27755

Properties
Regulator type:	Transcription factor
TF locus tag:	DORFOR_00808
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.8 Sequence: TTAGCACTCACCTCTTGACTGTGCTAA Locus tag: DORFOR_02181 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	DORFOR_02181	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -156 Score: 7.2 Sequence: TTAGCACTCGATGAAAAAGAGTGCTAA Locus tag: DORFOR_02548 Name: htpG Funciton: Heat shock chaperone protein 90
	DORFOR_02548	htpG	Heat shock chaperone protein 90
Position: -16 Score: 7 Sequence: ATAGCACTCTCTTTTTATGAGTGCTAA Locus tag: DORFOR_00902 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: DORFOR_00901 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	DORFOR_00902	groES	Heat shock protein 60 family co-chaperone GroES
	DORFOR_00901	groEL	Heat shock protein 60 family chaperone GroEL
Position: -180 Score: 7.2 Sequence: TTAGCACTCACCTCTTGACAGTGCTAA Locus tag: DORFOR_00449 Name: hsp20 Funciton: Heat shock protein Hsp20 Locus tag: DORFOR_00448 Name: hsp20 Funciton: Heat shock protein Hsp20
	DORFOR_00449	hsp20	Heat shock protein Hsp20
	DORFOR_00448	hsp20	Heat shock protein Hsp20
Position: -16 Score: 7.3 Sequence: TTAGCACTCCAATATAATGAGTGCTAA Locus tag: DORFOR_00808 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: DORFOR_00807 Name: grpE Funciton: Heat shock protein GrpE Locus tag: DORFOR_00806 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: DORFOR_00805 Name: dnaJ Funciton: Chaperone protein DnaJ
	DORFOR_00808	hrcA	heat-inducible transcription repressor HrcA
	DORFOR_00807	grpE	Heat shock protein GrpE
	DORFOR_00806	dnaK	Chaperone protein DnaK
	DORFOR_00805	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD