Regulon of HrcA in Clostridium scindens ATCC 35704

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOSCI_01188
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 7.3 Sequence: TTAGCACTCAATACTTGACAGTGCTAA Locus tag: CLOSCI_04021 Name: hsp20 Funciton: Heat shock protein Hsp20
	CLOSCI_04021	hsp20	Heat shock protein Hsp20
Position: -94 Score: 7.2 Sequence: TTAGCACTCACCTCTTGACAGTGCTAA Locus tag: CLOSCI_02798 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	CLOSCI_02798	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -397 Score: 7.5 Sequence: TTAGCACTCTCTTTTTATGAGTGCTAA Locus tag: CLOSCI_00050 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CLOSCI_00050	groEL	Heat shock protein 60 family chaperone GroEL
Position: -58 Score: 7.5 Sequence: TTAGCACTCTCTTTTTATGAGTGCTAA Locus tag: CLOSCI_00049 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES
	CLOSCI_00049	groES	Heat shock protein 60 family co-chaperone GroES
Position: -97 Score: 7.2 Sequence: TTAGCACTCATCTATTGACAGTGCTAA Locus tag: CLOSCI_02851 Name: hsp20 Funciton: Heat shock protein Hsp20
	CLOSCI_02851	hsp20	Heat shock protein Hsp20
Position: -54 Score: 7.3 Sequence: TTAGCACTCGAAAATGTAGAGTGCTAA Locus tag: CLOSCI_01188 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: CLOSCI_01189 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CLOSCI_01190 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: CLOSCI_01191 Name: dnaJ Funciton: Chaperone protein DnaJ
	CLOSCI_01188	hrcA	heat-inducible transcription repressor HrcA
	CLOSCI_01189	grpE	Heat shock protein GrpE
	CLOSCI_01190	dnaK	Chaperone protein DnaK
	CLOSCI_01191	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD