Regulon of HrcA in Clostridium nexile DSM 1787

Properties
Regulator type:	Transcription factor
TF locus tag:	CLONEX_00289
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-3
Statistics of regulated genes:
- Genes	7
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 81 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 7.1 Sequence: TTAGCACTCACCCCTTGACAGTGCTAA Locus tag: CLONEX_03685 Name: clpB Funciton: ATP-dependent Clp protease ATP-binding subunit ClpB
	CLONEX_03685	clpB	ATP-dependent Clp protease ATP-binding subunit ClpB
Position: -92 Score: 7.5 Sequence: TTAGCACTCACTTTAAAAGAGTGCTAA Locus tag: CLONEX_03837 Name: htpG Funciton: Heat shock chaperone protein 90
	CLONEX_03837	htpG	Heat shock chaperone protein 90
Position: -375 Score: 7 Sequence: TTAGCACTCGGACAAAGTGAGTGCTAA Locus tag: CLONEX_00414 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CLONEX_00414	groEL	Heat shock protein 60 family chaperone GroEL
Position: -63 Score: 7 Sequence: TTAGCACTCGGACAAAGTGAGTGCTAA Locus tag: CLONEX_00415 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES
	CLONEX_00415	groES	Heat shock protein 60 family co-chaperone GroES
Position: -136 Score: 7.2 Sequence: TTAGCACTCACCTCTTGACAGTGCTAA Locus tag: CLONEX_03691 Name: hsp20 Funciton: Heat shock protein Hsp20 Locus tag: CLONEX_03690 Name: dnaJ2 Funciton: Chaperone protein DnaJ
	CLONEX_03691	hsp20	Heat shock protein Hsp20
	CLONEX_03690	dnaJ2	Chaperone protein DnaJ
Position: -54 Score: 7.3 Sequence: TTAGCACTCGAAAGAATAGAGTGCTAA Locus tag: CLONEX_00290 Name: hrcA Funciton: heat-inducible transcription repressor HrcA
	CLONEX_00290	hrcA	heat-inducible transcription repressor HrcA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD