Regulon of PerR in Bacteroides coprophilus DSM 18228

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCOPRO_01403
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.2 Sequence: TCCTTTGTAATTATTATAAAAAT Locus tag: BACCOPRO_00522 Name: BT1211 Funciton: hypothetical protein
	BACCOPRO_00522	BT1211	hypothetical protein
Position: -55 Score: 6.1 Sequence: TGCATTGTAATAATTACAAATTT Locus tag: BACCOPRO_03297 Name: ahpC Funciton: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) Locus tag: BACCOPRO_03296 Name: ahpF Funciton: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
	BACCOPRO_03297	ahpC	Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
	BACCOPRO_03296	ahpF	Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
Position: -56 Score: 6.3 Sequence: ATATTTGTAATTATTACATATCT Locus tag: BACCOPRO_01040 Name: tpx Funciton: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
	BACCOPRO_01040	tpx	Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Position: -79 Score: 6 Sequence: ACAATTGTTATCTTTACAATTTT Locus tag: BACCOPRO_00708 Name: PF05140 Funciton: ResB protein required for cytochrome c biosynthesis Locus tag: BACCOPRO_00709 Name: ccsA Funciton: Cytochrome c biogenesis protein CcsA
	BACCOPRO_00708	PF05140	ResB protein required for cytochrome c biosynthesis
	BACCOPRO_00709	ccsA	Cytochrome c biogenesis protein CcsA
Position: -93 Score: 6.8 Sequence: AAAGTTGTAATGATTACAATTTT Locus tag: BACCOPRO_00127 Name: rbr2 Funciton: Rubrerythrin
	BACCOPRO_00127	rbr2	Rubrerythrin
Position: -33 Score: 6.1 Sequence: AAAATTGTAATAGTTACAGAATT Locus tag: BACCOPRO_01403 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACCOPRO_01402 Name: rbr Funciton: Rubrerythrin
	BACCOPRO_01403	perR	Peroxide stress regulator PerR, Fur family
	BACCOPRO_01402	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD