Regulon of PerR in Bacteroides vulgatus ATCC 8482

Properties
Regulator type:	Transcription factor
TF locus tag:	BVU_2366
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	12
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -276 Score: 5.9 Sequence: TTCTTTGTAATTATTACAACTTT Locus tag: BVU_2799 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BVU_2798 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BVU_2799	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BVU_2798	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -40 Score: 5.7 Sequence: ATATTTGCAACAGTTACAATTTA Locus tag: BVU_2754 Name: ftn Funciton: Ferritin
	BVU_2754	ftn	Ferritin
Position: -55 Score: 6 Sequence: GCAAATGTAATAATTACAATTTA Locus tag: BVU_0847 Name: ahpC Funciton: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) Locus tag: BVU_0846 Name: ahpF Funciton: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
	BVU_0847	ahpC	Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
	BVU_0846	ahpF	Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
Position: -44 Score: 5.7 Sequence: AAATTTGTTATCATTACAGTATC Locus tag: BVU_3944 Name: tpx Funciton: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
	BVU_3944	tpx	Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Position: -19 Score: 5.6 Sequence: AAAACTGTAATAATTATAAATGG Locus tag: BVU_1959 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BVU_1960 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BVU_1961 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BVU_1959	acn	Aconitate hydratase (EC 4.2.1.3)
	BVU_1960	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BVU_1961	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -30 Score: 6.1 Sequence: AAAATTGTAATAGTTACAAAAAG Locus tag: BVU_2366 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BVU_2367 Name: rbr Funciton: Rubrerythrin
	BVU_2366	perR	Peroxide stress regulator PerR, Fur family
	BVU_2367	rbr	Rubrerythrin
Position: -92 Score: 6.4 Sequence: GTAATTGTAATAAATACAATTTT Locus tag: BVU_1137 Name: rbr2 Funciton: Rubrerythrin
	BVU_1137	rbr2	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD