Regulon of PerR in Bacteroides uniformis ATCC 8492

Properties
Regulator type:	Transcription factor
TF locus tag:	BACUNI_01378
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: 70 Score: 6.5 Sequence: ATATTTGTAATCATTATAATTTT Locus tag: BACUNI_02171 Name: BT1211 Funciton: hypothetical protein Locus tag: BACUNI_02172 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACUNI_02173 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACUNI_02171	BT1211	hypothetical protein
	BACUNI_02172	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACUNI_02173	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -35 Score: 5 Sequence: TAATTTGTTATGTATACATATAA Locus tag: BACUNI_04341 Name: tpx Funciton: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
	BACUNI_04341	tpx	Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Position: -36 Score: 5.8 Sequence: ACTTTTGTAATGATTTCAATTTA Locus tag: BACUNI_04391 Name: ftn Funciton: Ferritin
	BACUNI_04391	ftn	Ferritin
Position: -45 Score: 6 Sequence: TAATTTGTAATCTTTACAATAAT Locus tag: BACUNI_01674 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BACUNI_01673 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BACUNI_01672 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BACUNI_01674	acn	Aconitate hydratase (EC 4.2.1.3)
	BACUNI_01673	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BACUNI_01672	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -38 Score: 6.6 Sequence: AAAAATGTAATAATTACAAGTTT Locus tag: BACUNI_01378 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACUNI_01379 Name: rbr Funciton: Rubrerythrin
	BACUNI_01378	perR	Peroxide stress regulator PerR, Fur family
	BACUNI_01379	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD