Regulon of PerR in Bacteroides stercoris ATCC 43183

Properties
Regulator type:	Transcription factor
TF locus tag:	BACSTE_01825
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.2 Sequence: ATATTTGTAATGATTATAATTTG Locus tag: BACSTE_00833 Name: BT1211 Funciton: hypothetical protein Locus tag: BACSTE_00832 Name: null Funciton: hypothetical protein Locus tag: BACSTE_00831 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACSTE_00830 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACSTE_00833	BT1211	hypothetical protein
	BACSTE_00832		hypothetical protein
	BACSTE_00831	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACSTE_00830	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -39 Score: 6.3 Sequence: ATATTTGTAATCATTTCAATTTA Locus tag: BACSTE_00720 Name: ftn Funciton: Ferritin
	BACSTE_00720	ftn	Ferritin
Position: -45 Score: 6.1 Sequence: TAATTTGTAATATTTACAATATT Locus tag: BACSTE_03162 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BACSTE_03161 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BACSTE_03160 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BACSTE_03162	acn	Aconitate hydratase (EC 4.2.1.3)
	BACSTE_03161	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BACSTE_03160	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -37 Score: 6.6 Sequence: AAAAATGTAATTATTACAAGTTT Locus tag: BACSTE_01825 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACSTE_01824 Name: rbr Funciton: Rubrerythrin
	BACSTE_01825	perR	Peroxide stress regulator PerR, Fur family
	BACSTE_01824	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD