Regulon of PerR in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_02660
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.5 Sequence: TACTTTGTAATCATTATAAAAAT Locus tag: BACPLE_02813 Name: BT1211 Funciton: hypothetical protein
	BACPLE_02813	BT1211	hypothetical protein
Position: -50 Score: 6.1 Sequence: ATATTTGTAATTGTTACAATCTT Locus tag: BACPLE_03494 Name: PF00576 Funciton: Transthyretin family protein
	BACPLE_03494	PF00576	Transthyretin family protein
Position: -79 Score: 5.9 Sequence: AGATTTGTTATCTTTACAATTTT Locus tag: BACPLE_02893 Name: PF05140 Funciton: ResB protein required for cytochrome c biosynthesis Locus tag: BACPLE_02892 Name: ccsA Funciton: Cytochrome c biogenesis protein CcsA Locus tag: BACPLE_02891 Name: ccp Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	BACPLE_02893	PF05140	ResB protein required for cytochrome c biosynthesis
	BACPLE_02892	ccsA	Cytochrome c biogenesis protein CcsA
	BACPLE_02891	ccp	Cytochrome c551 peroxidase (EC 1.11.1.5)
Position: -94 Score: 6.7 Sequence: AAAATTGTAATGATTTCAAATTT Locus tag: BACPLE_00297 Name: rbr2 Funciton: Rubrerythrin
	BACPLE_00297	rbr2	Rubrerythrin
Position: -33 Score: 5.9 Sequence: AGAATTGTAACAATTACATAATT Locus tag: BACPLE_02660 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACPLE_02659 Name: rbr Funciton: Rubrerythrin
	BACPLE_02660	perR	Peroxide stress regulator PerR, Fur family
	BACPLE_02659	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD