Regulon of PerR in Bacteroides ovatus ATCC 8483

Properties
Regulator type:	Transcription factor
TF locus tag:	BACOVA_00376
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.2 Sequence: ATATTTGTACTCATTACAAATTA Locus tag: BACOVA_03967 Name: BT1211 Funciton: hypothetical protein Locus tag: BACOVA_03968 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACOVA_03969 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACOVA_03967	BT1211	hypothetical protein
	BACOVA_03968	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACOVA_03969	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -33 Score: 5.6 Sequence: ATATTTGTAATAATTGTATTTAT Locus tag: BACOVA_02789 Name: PF01637 Funciton: Archaeal ATPase family protein
	BACOVA_02789	PF01637	Archaeal ATPase family protein
Position: -40 Score: 6.3 Sequence: ATAATTGTAATGAATACAACTTT Locus tag: BACOVA_00376 Name: perR Funciton: Peroxide stress regulator PerR, Fur family
	BACOVA_00376	perR	Peroxide stress regulator PerR, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD