Regulon of PerR in Bacteroides fragilis NCTC 9343

Properties
Regulator type:	Transcription factor
TF locus tag:	BF3019
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.9 Sequence: ATATTTGCAATAATTATAAATAT Locus tag: BF3647 Name: PF01637 Funciton: Archaeal ATPase family protein
	BF3647	PF01637	Archaeal ATPase family protein
Position: -86 Score: 6.2 Sequence: AAAATTGTATTTAATACAAATTA Locus tag: BF2364 Name: PF05140 Funciton: ResB protein required for cytochrome c biosynthesis Locus tag: BF2363 Name: ccsA Funciton: Cytochrome c biogenesis protein CcsA Locus tag: BF2362 Name: ccp Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	BF2364	PF05140	ResB protein required for cytochrome c biosynthesis
	BF2363	ccsA	Cytochrome c biogenesis protein CcsA
	BF2362	ccp	Cytochrome c551 peroxidase (EC 1.11.1.5)
Position: -39 Score: 6.8 Sequence: AAAATTGTAATGAATACAATTTT Locus tag: BF3019 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BF3018 Name: rbr Funciton: Rubrerythrin
	BF3019	perR	Peroxide stress regulator PerR, Fur family
	BF3018	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD