Regulon of PerR in Bacteroides eggerthii DSM 20697

Properties
Regulator type:	Transcription factor
TF locus tag:	BACEGG_01512
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 6.2 Sequence: ATATTTGTAATGATTATAATTTG Locus tag: BACEGG_02389 Name: BT1211 Funciton: hypothetical protein Locus tag: BACEGG_02390 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACEGG_02391 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACEGG_02389	BT1211	hypothetical protein
	BACEGG_02390	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACEGG_02391	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -39 Score: 6.3 Sequence: ATATTTGTAATCATTTCAATTTA Locus tag: BACEGG_01676 Name: ftn Funciton: Ferritin
	BACEGG_01676	ftn	Ferritin
Position: -48 Score: 6.1 Sequence: TAATTTGTAATCTTTACAATATT Locus tag: BACEGG_00294 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BACEGG_00295 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BACEGG_00296 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BACEGG_00294	acn	Aconitate hydratase (EC 4.2.1.3)
	BACEGG_00295	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BACEGG_00296	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -37 Score: 6.6 Sequence: AAAAATGTAATTATTACAAGTTT Locus tag: BACEGG_01512 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACEGG_01511 Name: rbr Funciton: Rubrerythrin
	BACEGG_01512	perR	Peroxide stress regulator PerR, Fur family
	BACEGG_01511	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD