Regulon of PerR in Bacteroides dorei DSM 17855

Properties
Regulator type:	Transcription factor
TF locus tag:	BACDOR_03683
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	13
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 6.1 Sequence: AAAATTGTAATAGTTACAAAAAG Locus tag: BACDOR_03683 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACDOR_03684 Name: rbr Funciton: Rubrerythrin
	BACDOR_03683	perR	Peroxide stress regulator PerR, Fur family
	BACDOR_03684	rbr	Rubrerythrin
Position: -34 Score: 5.9 Sequence: TTCTTTGTAATTATTACAACTTT Locus tag: BACDOR_04415 Name: BT1211 Funciton: hypothetical protein Locus tag: BACDOR_04414 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACDOR_04413 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACDOR_04415	BT1211	hypothetical protein
	BACDOR_04414	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACDOR_04413	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -41 Score: 5.7 Sequence: ATATTTGCAACAGTTACAATTTA Locus tag: BACDOR_04357 Name: ftn Funciton: Ferritin
	BACDOR_04357	ftn	Ferritin
Position: -55 Score: 6 Sequence: GCAAATGTAATAATTACAATTTA Locus tag: BACDOR_04898 Name: ahpC Funciton: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) Locus tag: BACDOR_04897 Name: ahpF Funciton: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
	BACDOR_04898	ahpC	Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
	BACDOR_04897	ahpF	Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
Position: -44 Score: 5.7 Sequence: AAATTTGTTATCATTACAGTATC Locus tag: BACDOR_00877 Name: tpx Funciton: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
	BACDOR_00877	tpx	Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Position: -25 Score: 5.9 Sequence: AAAACTGTAATAATTATAAATTG Locus tag: BACDOR_03102 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BACDOR_03101 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BACDOR_03100 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BACDOR_03102	acn	Aconitate hydratase (EC 4.2.1.3)
	BACDOR_03101	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BACDOR_03100	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -93 Score: 6.7 Sequence: ATAATTGTAATGAATACAATTTT Locus tag: BACDOR_01950 Name: rbr2 Funciton: Rubrerythrin
	BACDOR_01950	rbr2	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PerR in Bacteroides dorei DSM 17855

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --