Regulon of PerR in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_05678
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Regulog:	PerR - Bacteroidaceae
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - FUR
By effector - Hydrogen peroxide
By pathway - Peroxide stress response
By pathway - Oxidative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.5 Sequence: ATATTTGTAATGATTATAAATTT Locus tag: BACCELL_04244 Name: BT1211 Funciton: hypothetical protein Locus tag: BACCELL_04245 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACCELL_04246 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BACCELL_04244	BT1211	hypothetical protein
	BACCELL_04245	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BACCELL_04246	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -40 Score: 5.8 Sequence: ACTTTTGTAATGATTTCAAATTA Locus tag: BACCELL_00354 Name: ftn Funciton: Ferritin
	BACCELL_00354	ftn	Ferritin
Position: -47 Score: 6.1 Sequence: TAATTTGTAATCTTTACAATATT Locus tag: BACCELL_00993 Name: acn Funciton: Aconitate hydratase (EC 4.2.1.3) Locus tag: BACCELL_00994 Name: icd Funciton: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42) Locus tag: BACCELL_00995 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
	BACCELL_00993	acn	Aconitate hydratase (EC 4.2.1.3)
	BACCELL_00994	icd	Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
	BACCELL_00995	gltA	Citrate synthase (si) (EC 2.3.3.1)
Position: -36 Score: 6.6 Sequence: AAAAATGTAATTATTACAAGTTT Locus tag: BACCELL_05678 Name: perR Funciton: Peroxide stress regulator PerR, Fur family Locus tag: BACCELL_05679 Name: rbr Funciton: Rubrerythrin
	BACCELL_05678	perR	Peroxide stress regulator PerR, Fur family
	BACCELL_05679	rbr	Rubrerythrin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD