Regulon of NanR in Bacteroides vulgatus ATCC 8482

Properties
Regulator type:	Transcription factor
TF locus tag:	BVU_4116
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	18
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 4.8 Sequence: ATTTCAATAAAAACTTTTATTTT Locus tag: BVU_4143 Name: nanH Funciton: Sialidase (EC 3.2.1.18) Locus tag: BVU_4142 Name: nahA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: BVU_4141 Name: estA Funciton: Sialate-O-acetyltransferase Locus tag: BVU_4140 Name: estS Funciton: Sialic acid-specific 9-O-acetylesterase Locus tag: BVU_4139 Name: bmnA Funciton: Beta-mannosidase (EC 3.2.1.25) Locus tag: BVU_4138 Name: nahB Funciton: Beta-hexosaminidase (EC 3.2.1.52)
	BVU_4143	nanH	Sialidase (EC 3.2.1.18)
	BVU_4142	nahA	Beta-hexosaminidase (EC 3.2.1.52)
	BVU_4141	estA	Sialate-O-acetyltransferase
	BVU_4140	estS	Sialic acid-specific 9-O-acetylesterase
	BVU_4139	bmnA	Beta-mannosidase (EC 3.2.1.25)
	BVU_4138	nahB	Beta-hexosaminidase (EC 3.2.1.52)
Position: -190 Score: 5.5 Sequence: AAACTAAATTTATTTATTAATAA Locus tag: BVU_4116 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BVU_4116	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -38 Score: 5 Sequence: AAGTTCATTTAATTTTTTAATTA Position: -18 Score: 5.1 Sequence: TTAATAAATTACTAATTTATGAA Position: -5 Score: 5 Sequence: TAATTATGAAAGTATTTTATTAT Locus tag: BVU_2029 Name: susC_Nan-1 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BVU_2030 Name: susD_Nan-1 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers Locus tag: BVU_2031 Name: GH43 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
	BVU_2029	susC_Nan-1	TonB-dependent outer membrane transporter of sialic acid oligomers
	BVU_2030	susD_Nan-1	Outer membrane polysaccharide binding protein for sialic acid oligomers
	BVU_2031	GH43	Glycosyl hydrolase family 43, five-bladed beta-propellor domain
Position: -111 Score: 5.5 Sequence: TTATTAATAAATAAATTTAGTTT Position: -108 Score: 5.2 Sequence: TTAATAAATAAATTTAGTTTTTA Position: -40 Score: 4.8 Sequence: TAAGTAATATAAAATATTCATTT Locus tag: BVU_4117 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: BVU_4118 Name: nanE-II Funciton: N-acetylmannosamine 2-epimerase Locus tag: BVU_4119 Name: nanT-II Funciton: Predicted N-acetyl-neuraminate transporter, MFS family Locus tag: BVU_4120 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) Locus tag: BVU_4121 Name: nagB-II Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
	BVU_4117	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	BVU_4118	nanE-II	N-acetylmannosamine 2-epimerase
	BVU_4119	nanT-II	Predicted N-acetyl-neuraminate transporter, MFS family
	BVU_4120	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	BVU_4121	nagB-II	Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
Position: -92 Score: 6.1 Sequence: TTTTTAATAAATTATTTTATTAA Locus tag: BVU_2433 Name: fucA Funciton: Alpha-L-fucosidase (EC 3.2.1.51) Locus tag: BVU_2432 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BVU_2431 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
	BVU_2433	fucA	Alpha-L-fucosidase (EC 3.2.1.51)
	BVU_2432	susC_Nan-5	TonB-dependent outer membrane transporter of sialic acid oligomers
	BVU_2431	susD_Nan-5	Outer membrane polysaccharide binding protein for sialic acid oligomers

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of NanR in Bacteroides vulgatus ATCC 8482

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --