Regulon of NanR in Bacteroides uniformis ATCC 8492

Properties
Regulator type:	Transcription factor
TF locus tag:	BACUNI_02075
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.1 Sequence: AATTTACAAAATTATTTTAGTAT Locus tag: BACUNI_02075 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BACUNI_02075	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -26 Score: 5 Sequence: ATATTAACAAAATCTTTTAAAGA Locus tag: BACUNI_01205 Name: bgaA Funciton: Beta-galactosidase (EC 3.2.1.23)
	BACUNI_01205	bgaA	Beta-galactosidase (EC 3.2.1.23)
Position: -18 Score: 5.3 Sequence: TTATTAATAATAAATTTTATGAA Locus tag: BACUNI_01404 Name: nagB-II Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
	BACUNI_01404	nagB-II	Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
Position: -25 Score: 5.6 Sequence: TTAATAACTAATTAAATTAATAT Position: -21 Score: 4.8 Sequence: TAACTAATTAAATTAATATTTAT Locus tag: BACUNI_01022 Name: susC_Nan-6 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACUNI_01023 Name: susD_Nan-6 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
	BACUNI_01022	susC_Nan-6	TonB-dependent outer membrane transporter of sialic acid oligomers
	BACUNI_01023	susD_Nan-6	Outer membrane polysaccharide binding protein for sialic acid oligomers
Position: -44 Score: 5.9 Sequence: ATAATAAATAAATTAATTAATTA Locus tag: BACUNI_01658 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACUNI_01657 Name: null Funciton: hypothetical protein Locus tag: BACUNI_01656 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACUNI_01655 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
	BACUNI_01658	exbB	Outer membrane transport system, transport protein ExbB
	BACUNI_01657		hypothetical protein
	BACUNI_01656	exbD	Outer membrane transport system, transport protein ExbD
	BACUNI_01655	exbD2	Outer membrane transport system, transport protein ExbD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD