Regulon of NanR in Bacteroides thetaiotaomicron VPI-5482

Properties
Regulator type:	Transcription factor
TF locus tag:	BT0433
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.8 Sequence: TTAATAAAAAAATTAATTATCTT Locus tag: BT0433 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BT0433	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -98 Score: 6.3 Sequence: TTATTAATAAAATATTTTATTAT Position: -95 Score: 5.9 Sequence: TTAATAAAATATTTTATTATCTA Locus tag: BT0434 Name: BT0434 Funciton: NTP pyrophosphohydrolases including oxidative damage repair enzymes Locus tag: BT0435 Name: SSF51445 Funciton: Glycoside hydrolase, superfamily SSF51445 Locus tag: BT0436 Name: nanJ Funciton: Predicted sialic acid transporter, AraJ-MFS family Locus tag: BT0437 Name: nanE-II Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8) Locus tag: BT0438 Name: agaN Funciton: Alpha-N-acetylglucosaminidase (EC 3.2.1.50)
	BT0434	BT0434	NTP pyrophosphohydrolases including oxidative damage repair enzymes
	BT0435	SSF51445	Glycoside hydrolase, superfamily SSF51445
	BT0436	nanJ	Predicted sialic acid transporter, AraJ-MFS family
	BT0437	nanE-II	N-acylglucosamine 2-epimerase (EC 5.1.3.8)
	BT0438	agaN	Alpha-N-acetylglucosaminidase (EC 3.2.1.50)
Position: -39 Score: 4.8 Sequence: ATAATAATCAATTAATTAATCTT Locus tag: BT2055 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BT2054 Name: null Funciton: hypothetical protein Locus tag: BT2053 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BT2052 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
	BT2055	exbB	Outer membrane transport system, transport protein ExbB
	BT2054		hypothetical protein
	BT2053	exbD	Outer membrane transport system, transport protein ExbD
	BT2052	exbD2	Outer membrane transport system, transport protein ExbD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD