Regulon of NanR in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_00597
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 5 Sequence: ATAATAAATTTATATATTTACAT Locus tag: BACPLE_02962 Name: nahC Funciton: Beta-hexosaminidase (EC 3.2.1.52)
	BACPLE_02962	nahC	Beta-hexosaminidase (EC 3.2.1.52)
Position: -234 Score: 5.4 Sequence: TCATTAATAAATTATTATATTTA Locus tag: BACPLE_00596 Name: nanM Funciton: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
	BACPLE_00596	nanM	Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
Position: -88 Score: 5.4 Sequence: TAAATATAATAATTTATTAATGA Locus tag: BACPLE_00597 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BACPLE_00597	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -122 Score: 4.9 Sequence: TAAAAAATCTATTTTTTTATTTG Locus tag: BACPLE_01828 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	BACPLE_01828	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -267 Score: 5.2 Sequence: TATATAAATAATATTTTTATCAT Position: -156 Score: 5 Sequence: TTCATAAAATATTTTATCAAATA Locus tag: BACPLE_00590 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACPLE_00589 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
	BACPLE_00590	susC_Nan-5	TonB-dependent outer membrane transporter of sialic acid oligomers
	BACPLE_00589	susD_Nan-5	Outer membrane polysaccharide binding protein for sialic acid oligomers

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD