Regulon of NanR in Bacteroides ovatus ATCC 8483

Properties
Regulator type:	Transcription factor
TF locus tag:	BACOVA_01791
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	18
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.8 Sequence: TTAATAAAAAAATTAATTATCTT Locus tag: BACOVA_01791 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BACOVA_01791	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -103 Score: 6.3 Sequence: TTATTAATAAAATATTTTATTAT Position: -100 Score: 5.9 Sequence: TTAATAAAATATTTTATTATCTA Locus tag: BACOVA_01792 Name: BT0434 Funciton: NTP pyrophosphohydrolases including oxidative damage repair enzymes Locus tag: BACOVA_01793 Name: SSF51445 Funciton: Glycoside hydrolase, superfamily SSF51445 Locus tag: BACOVA_01794 Name: nanJ Funciton: Predicted sialic acid transporter, AraJ-MFS family Locus tag: BACOVA_01795 Name: nanE-II Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8) Locus tag: BACOVA_01796 Name: susC_Nan-4 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACOVA_01797 Name: susD_Nan-4 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers Locus tag: BACOVA_01798 Name: BT0450 Funciton: hypothetical protein Locus tag: BACOVA_01799 Name: PF09992 Funciton: Predicted periplasmic protein, PF09992 family Locus tag: BACOVA_01800 Name: PF02638 Funciton: S-layer related protein precursor, sialic acid-specific 9-O-acetylesterase
	BACOVA_01792	BT0434	NTP pyrophosphohydrolases including oxidative damage repair enzymes
	BACOVA_01793	SSF51445	Glycoside hydrolase, superfamily SSF51445
	BACOVA_01794	nanJ	Predicted sialic acid transporter, AraJ-MFS family
	BACOVA_01795	nanE-II	N-acylglucosamine 2-epimerase (EC 5.1.3.8)
	BACOVA_01796	susC_Nan-4	TonB-dependent outer membrane transporter of sialic acid oligomers
	BACOVA_01797	susD_Nan-4	Outer membrane polysaccharide binding protein for sialic acid oligomers
	BACOVA_01798	BT0450	hypothetical protein
	BACOVA_01799	PF09992	Predicted periplasmic protein, PF09992 family
	BACOVA_01800	PF02638	S-layer related protein precursor, sialic acid-specific 9-O-acetylesterase
Position: -194 Score: 4.9 Sequence: AAAATAACTAAATATATTAAACT Locus tag: BACOVA_00275 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: BACOVA_00274 Name: nanE-II Funciton: N-acetylmannosamine 2-epimerase Locus tag: BACOVA_00273 Name: PF04074 Funciton: Conserved hypothetical protein, PF04074 family Locus tag: BACOVA_00272 Name: nanT-II Funciton: Predicted N-acetyl-neuraminate transporter, MFS family
	BACOVA_00275	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	BACOVA_00274	nanE-II	N-acetylmannosamine 2-epimerase
	BACOVA_00273	PF04074	Conserved hypothetical protein, PF04074 family
	BACOVA_00272	nanT-II	Predicted N-acetyl-neuraminate transporter, MFS family
Position: -39 Score: 4.8 Sequence: ATAATAATCAATTAATTAATCTT Locus tag: BACOVA_00648 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACOVA_00649 Name: null Funciton: hypothetical protein Locus tag: BACOVA_00650 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACOVA_00651 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
	BACOVA_00648	exbB	Outer membrane transport system, transport protein ExbB
	BACOVA_00649		hypothetical protein
	BACOVA_00650	exbD	Outer membrane transport system, transport protein ExbD
	BACOVA_00651	exbD2	Outer membrane transport system, transport protein ExbD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of NanR in Bacteroides ovatus ATCC 8483

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --