Regulon of NanR in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_04950
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.7 Sequence: ATAATAAACAAATTAATTAATTA Locus tag: BACCELL_01010 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACCELL_01011 Name: null Funciton: hypothetical protein Locus tag: BACCELL_01012 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACCELL_01013 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
	BACCELL_01010	exbB	Outer membrane transport system, transport protein ExbB
	BACCELL_01011		hypothetical protein
	BACCELL_01012	exbD	Outer membrane transport system, transport protein ExbD
	BACCELL_01013	exbD2	Outer membrane transport system, transport protein ExbD
Position: -37 Score: 5.5 Sequence: ATATTAATAAAATTATTAAGTAT Locus tag: BACCELL_04950 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BACCELL_04950	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD