Regulon of FruR in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_1349
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Fructose utilization
Effector:	Fructose-6-phosphate
Regulog:	FruR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - DeoR
By effector - Fructose-6-phosphate
By pathway - Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.1 Sequence: TGACAGTTGTTGAATGTTTT Position: -72 Score: 5.9 Sequence: TGAATGTTTTTGCACGTTTT Locus tag: LSEI_1349 Name: fruR Funciton: Fructose utilization transcriptional regulator FruR, DeoR family Locus tag: LSEI_1348 Name: fruB Funciton: 1-phosphofructokinase (EC 2.7.1.56) Locus tag: LSEI_1347 Name: fruA Funciton: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
	LSEI_1349	fruR	Fructose utilization transcriptional regulator FruR, DeoR family
	LSEI_1348	fruB	1-phosphofructokinase (EC 2.7.1.56)
	LSEI_1347	fruA	Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD