Regulog FruR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - DeoR
- By effector - Fructose-6-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | 3 | 1 |
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | 3 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | 3 | 1 |
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | 3 | 1 |
| Lactobacillus johnsonii NCC 533 | 3 | 1 |
| Lactobacillus plantarum WCFS1 | 3 | 1 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 3 | 1 |
| Lactobacillus sakei subsp. sakei 23K | 3 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | 3 | 1 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 3 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| fruR |
*
Lactobacillus acidophilus NCFM Site: position = -52 score = 4.54973 sequence = TGGTTGATTTTGATGGAGAA Site: position = -62 score = 4.53617 sequence = TGAAGAAAAATGGTTGATTT Gene: LBA1779: Fructose utilization transcriptional regulator FruR, DeoR family |
|
*
Lactobacillus casei ATCC 334 Site: position = -82 score = 5.14286 sequence = TGACAGTTGTTGAATGTTTT Site: position = -72 score = 5.94695 sequence = TGAATGTTTTTGCACGTTTT Gene: LSEI_1349: Fructose utilization transcriptional regulator FruR, DeoR family |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -189 score = 4.57238 sequence = TGACGGAAAATGATTGCTTT Gene: LBUL_1889: Fructose utilization transcriptional regulator FruR, DeoR family |
|
*
Lactobacillus helveticus DPC 4571 Site: position = -13 score = 5.83636 sequence = TGAATAAATATGATTGATTT Site: position = -3 score = 5.18472 sequence = TGATTGATTTTGAAAGAGAA Gene: lhv_1846: Fructose utilization transcriptional regulator FruR, DeoR family |
*
Lactobacillus johnsonii NCC 533 Site: position = -95 score = 5.26174 sequence = TGACTAATATTGAATGAATA Site: position = -85 score = 6.15816 sequence = TGAATGAATATGAATGATTT Gene: LJ0570: Fructose utilization transcriptional regulator FruR, DeoR family |
*
Lactobacillus plantarum WCFS1 Site: position = -82 score = 5.21032 sequence = TGGATTATTTTGACGGTTTT Site: position = -72 score = 5.74112 sequence = TGACGGTTTTTGAAGGTTTT Gene: lp_2095: Fructose utilization transcriptional regulator FruR, DeoR family |
|
*
Lactobacillus rhamnosus GG Site: position = -72 score = 5.64535 sequence = TGAATGTTTTTAACGGTTTT Gene: LGG_01361: Fructose utilization transcriptional regulator FruR, DeoR family |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -83 score = 6.10574 sequence = TGATTGTTTTTGAACGTTTT Site: position = -73 score = 5.37591 sequence = TGAACGTTTTTGAAATATTT Gene: LSA1048: Fructose utilization transcriptional regulator FruR, DeoR family |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -71 score = 5.04614 sequence = TGATTTTTTTTGACTATTTA Site: position = -61 score = 5.66317 sequence = TGACTATTTATGATTGAATT Gene: LSL_0163: Fructose utilization transcriptional regulator FruR, DeoR family |
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -73 score = 5.87642 sequence = TGAATTTTTTTGAATTAATT Site: position = -63 score = 6.06563 sequence = TGAATTAATTTGATTGATTT Gene: PEPE_1166: Fructose utilization transcriptional regulator FruR, DeoR family |
Fructose utilization transcriptional regulator FruR, DeoR family |
| fruB |
Gene: LBA1778: 1-phosphofructokinase (EC 2.7.1.56) |
|
Gene: LSEI_1348: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: LBUL_1888: 1-phosphofructokinase (EC 2.7.1.56) |
|
Gene: lhv_1845: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: LJ0571: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: lp_2096: 1-phosphofructokinase (EC 2.7.1.56) |
|
Gene: LGG_01360: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: LSA1049: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: LSL_0164: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
Gene: PEPE_1165: 1-phosphofructokinase (EC 2.7.1.56) |
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
Gene: LBA1777: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
|
Gene: LSEI_1347: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Gene: LBUL_1887: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
|
Gene: lhv_1844: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Gene: LJ0572: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Gene: lp_2097: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
|
Gene: LGG_01359: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Gene: LSA1050: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Gene: LSL_0165: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
|
|
Gene: PEPE_1164: Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Fructose-specific PTS, EIIABC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |