Regulon of UxaR in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_04799
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Glucuronate utilization; Galacturonate utilization
Effector:	Glucuronate; Galacturonate
Regulog:	UxaR - Bacteroidaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - LacI
By effector - Glucuronate
By effector - Galacturonate
By pathway - Glucuronate utilization
By pathway - Galacturonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 6.1 Sequence: AAAATAATTCGTATCTTTGC Locus tag: BACCELL_04799 Name: uxaR Funciton: Predicted transcriptional regulator for galacturonate catabolism, LacI family Locus tag: BACCELL_04800 Name: uxaB Funciton: Altronate oxidoreductase (EC 1.1.1.58)
	BACCELL_04799	uxaR	Predicted transcriptional regulator for galacturonate catabolism, LacI family
	BACCELL_04800	uxaB	Altronate oxidoreductase (EC 1.1.1.58)
Position: -166 Score: 6.1 Sequence: GCAAAGATACGAATTATTTT Locus tag: BACCELL_04798 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12)
	BACCELL_04798	uxaC	Uronate isomerase (EC 5.3.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD