Regulon of CcpN in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA1142
Regulator family:	CcpN
Regulation mode:	repressor
Biological process:	Gluconeogenesis
Effector:
Regulog:	CcpN - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CcpN
By pathway - Gluconeogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -138 Score: 5.4 Sequence: ATATAGTGTGTCACATTACAA Locus tag: LSA1142 Name: ccpN Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family Locus tag: LSA1143 Name: yqfL Funciton: Predicted phosphotransferase
	LSA1142	ccpN	Gluconeogenesis transcriptional regulator CcpN, CcpN family
	LSA1143	yqfL	Predicted phosphotransferase
Position: -55 Score: 5.4 Sequence: TTGTAATGTGACACACTATAT Locus tag: LSA1141 Name: ppdK Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
	LSA1141	ppdK	Pyruvate phosphate dikinase (EC 2.7.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD