Regulog CcpN - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | CcpN |
| Regulation mode: | repressor |
| Biological process: | Gluconeogenesis |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - CcpN
- By pathway - Gluconeogenesis
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | 1 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 1 | 1 |
| Lactobacillus sakei subsp. sakei 23K | 3 | 2 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | 1 | 1 |
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| ccpN |
|
|
Gene: LSEI_2335: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
|
|
|
|
|
Gene: LGG_02352: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -138 score = 5.43934 sequence = ATATAGTGTGTCACATTACAA Gene: LSA1142: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
|
*
Oenococcus oeni PSU-1 Site: position = -144 score = 4.44169 sequence = TAATTATGTTTAATAAAAAAA Gene: OEOE_1329: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
Gluconeogenesis transcriptional regulator CcpN, CcpN family |
| yqfL |
Gene: LBA1206: Predicted phosphotransferase |
Gene: LVIS_0743: Predicted phosphotransferase |
Gene: LSEI_1522: Predicted phosphotransferase |
Gene: LBUL_1174: Predicted phosphotransferase |
|
Gene: lhv_1306: Predicted phosphotransferase |
Gene: LJ1326: Predicted phosphotransferase |
Gene: lp_1974: Predicted phosphotransferase |
|
Gene: LGG_01557: Predicted phosphotransferase |
2
Lactobacillus sakei subsp. sakei 23K Gene: LSA1143: Predicted phosphotransferase Gene: LSA0872: Predicted phosphotransferase |
Gene: LSL_0699: Predicted phosphotransferase |
|
|
Gene: PEPE_1110: Predicted phosphotransferase |
Predicted phosphotransferase |
| CRON 2. | ||||||||||||||||
| ppdK |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -196 score = 4.68792 sequence = TTTTTAAATATCTCATTGAAA Site: position = -66 score = 5.0318 sequence = TTCAAAAATAATACATTATAA Gene: LSEI_2334: Pyruvate phosphate dikinase (EC 2.7.9.1) |
|
|
|
|
|
|
*
Lactobacillus rhamnosus GG Site: position = -66 score = 4.66211 sequence = CTGCTAAATAATACATTATAT Gene: LGG_02351: Pyruvate phosphate dikinase (EC 2.7.9.1) |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -55 score = 5.43934 sequence = TTGTAATGTGACACACTATAT Gene: LSA1141: Pyruvate phosphate dikinase (EC 2.7.9.1) |
|
|
|
|
Pyruvate phosphate dikinase (EC 2.7.9.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |