Regulon of SAG1808 in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_2087
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SAG1808 - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.9 Sequence: TAAGTTAACCGCTTCGCCCA Locus tag: SSA_2086 Name: SAG1807 Funciton: Conserved hypothetical protein Locus tag: SSA_2085 Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain Locus tag: SSA_2084 Name: SAG1805 Funciton: Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS Locus tag: SSA_2083 Name: SAG1804 Funciton: Conserved hypothetical protein Locus tag: SSA_2082 Name: SAG1803 Funciton: Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase
	SSA_2086	SAG1807	Conserved hypothetical protein
	SSA_2085	PF00389	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
	SSA_2084	SAG1805	Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
	SSA_2083	SAG1804	Conserved hypothetical protein
	SSA_2082	SAG1803	Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD