Regulon of SAG1808 in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1808
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SAG1808 - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 6.8 Sequence: TGAGTTAACCGTTTAACTTA Position: -48 Score: 6.7 Sequence: TTAGTTAAACGGTTAACTCA Locus tag: SAG1807 Name: SAG1807 Funciton: Conserved hypothetical protein Locus tag: SAG1806 Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain Locus tag: SAG1805 Name: SAG1805 Funciton: Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS Locus tag: SAG1804 Name: SAG1804 Funciton: Conserved hypothetical protein Locus tag: SAG1803 Name: SAG1803 Funciton: Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase
	SAG1807	SAG1807	Conserved hypothetical protein
	SAG1806	PF00389	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
	SAG1805	SAG1805	Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
	SAG1804	SAG1804	Conserved hypothetical protein
	SAG1803	SAG1803	Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD