Regulon of BfrR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB0303
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.5 Sequence: AAAATGAAACGTTTCAAATA Position: -31 Score: 6.5 Sequence: AAAATGAAACGTTTCAAAAA Locus tag: SUB0304 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: SUB0305 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: SUB0306 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: SUB0307 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
	SUB0304	bfrF	Fructooligosaccharides ABC transporter, permease protein 1
	SUB0305	bfrG	Fructooligosaccharides ABC transporter, permease protein 2
	SUB0306	bfrE	Fructooligosaccharides ABC transporter, substrate-binding protein
	SUB0307	bfrA	Beta-fructosidases (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD