Regulon of BfrR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_1341
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 6.1 Sequence: TTATTGAAACGTTTCACAAG Locus tag: SSU05_1341 Name: bfrR Funciton: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family Locus tag: SSU05_1340 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: SSU05_1339 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: SSU05_1338 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: SSU05_1337 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
	SSU05_1341	bfrR	Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
	SSU05_1340	bfrF	Fructooligosaccharides ABC transporter, permease protein 1
	SSU05_1339	bfrG	Fructooligosaccharides ABC transporter, permease protein 2
	SSU05_1338	bfrE	Fructooligosaccharides ABC transporter, substrate-binding protein
	SSU05_1337	bfrA	Beta-fructosidases (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD