Regulon of BfrR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_1799
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 6.5 Sequence: AAAATGAAACGTTTCAAAAA Position: -31 Score: 6.5 Sequence: AAAATGAAACGTTTCAAAAA Locus tag: SP_1798 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: SP_1797 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: SP_1796 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: SP_1795 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
	SP_1798	bfrF	Fructooligosaccharides ABC transporter, permease protein 1
	SP_1797	bfrG	Fructooligosaccharides ABC transporter, permease protein 2
	SP_1796	bfrE	Fructooligosaccharides ABC transporter, substrate-binding protein
	SP_1795	bfrA	Beta-fructosidases (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD