Regulon of Cagg_1084 in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_1084
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog:	Cagg_1084 - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - GntR/Others

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 7.4 Sequence: ATACATCAGATGATCTGATGTTT Locus tag: Cagg_1085 Name: COG0730 Funciton: predicted transporter
	Cagg_1085	COG0730	predicted transporter
Position: -36 Score: 7.3 Sequence: AAACATCAGATGATATGATCTTT Locus tag: Cagg_1084 Name: Cagg_1084 Funciton: Transcriptional regulator, GntR family
	Cagg_1084	Cagg_1084	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD