Regulog Cagg_1084 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - GntR/Others
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 2 | 2 |
| Chloroflexus sp. Y-400-fl | 2 | 2 |
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | ||
| Roseiflexus sp. RS-1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| COG0730 |
*
Chloroflexus aggregans DSM 9485 Site: position = -81 score = 7.4353 sequence = ATACATCAGATGATCTGATGTTT Gene: Cagg_1085: predicted transporter |
*
Chloroflexus sp. Y-400-fl Site: position = -41 score = 6.87834 sequence = AAACATCAGATCATCAGATGAAT Gene: Chy400_3102: predicted transporter |
|
|
|
predicted transporter |
| CRON 2. | ||||||
| Cagg_1084 |
*
Chloroflexus aggregans DSM 9485 Site: position = -36 score = 7.27093 sequence = AAACATCAGATGATATGATCTTT Gene: Cagg_1084: Transcriptional regulator, GntR family |
*
Chloroflexus sp. Y-400-fl Site: position = -37 score = 7.27093 sequence = AAACATCAGATGATATGATCTTT Gene: Chy400_3103: Transcriptional regulator, GntR family |
|
|
|
Transcriptional regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |