Regulog Cagg_1084 - Chloroflexia

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum:	Chloroflexi
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	2	2
Chloroflexus sp. Y-400-fl	2	2
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
COG0730	* Chloroflexus aggregans DSM 9485 Site: position = -81 score = 7.4353 sequence = ATACATCAGATGATCTGATGTTT Gene: Cagg_1085: predicted transporter	* Chloroflexus sp. Y-400-fl Site: position = -41 score = 6.87834 sequence = AAACATCAGATCATCAGATGAAT Gene: Chy400_3102: predicted transporter	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	predicted transporter

CRON 2.
Cagg_1084	* Chloroflexus aggregans DSM 9485 Site: position = -36 score = 7.27093 sequence = AAACATCAGATGATATGATCTTT Gene: Cagg_1084: Transcriptional regulator, GntR family	* Chloroflexus sp. Y-400-fl Site: position = -37 score = 7.27093 sequence = AAACATCAGATGATATGATCTTT Gene: Chy400_3103: Transcriptional regulator, GntR family	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Transcriptional regulator, GntR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --