Regulon of HcpR in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_0595
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	HcpR - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - HcpR
By TF family - CRP
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 6.5 Sequence: AACTTGCGCCAGCGCAACGA Locus tag: RoseRS_0596 Name: Rcas_3898 Funciton: Cytochrome c family protein involved in nitrosative stress Locus tag: RoseRS_0597 Name: Rcas_3899 Funciton: hypothetical protein involved in nitrosative stress
	RoseRS_0596	Rcas_3898	Cytochrome c family protein involved in nitrosative stress
	RoseRS_0597	Rcas_3899	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD