Regulon of HcpR in Roseiflexus sp. RS-1
| Regulator type: | Transcription factor |
| TF locus tag: | RoseRS_0595 |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Regulog: | HcpR - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By trascription factor - HcpR
- By TF family - CRP
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -105
Score: 6.5 Sequence: AACTTGCGCCAGCGCAACGA
Locus tag: RoseRS_0596
Name: Rcas_3898 Funciton: Cytochrome c family protein involved in nitrosative stress
Locus tag: RoseRS_0597
Name: Rcas_3899 Funciton: hypothetical protein involved in nitrosative stress |
|||
|
Rcas_3898
|
Cytochrome c family protein involved in nitrosative stress
|
||
|
Rcas_3899
|
hypothetical protein involved in nitrosative stress
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |