Profile of regulator HcpR in Chloroflexia

Properties
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	HcpR - Chloroflexia

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - HcpR
By TF family - CRP
By effector - Nitric oxide
By pathway - Nitrosative stress response

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Chloroflexus aggregans DSM 9485
	Cagg_2669	Rcas_3898	-86	6.8	AAGTTGCGCTAGCGCAACGT
	Cagg_2026	Rcas_3898	-116	6.5	ATCTTGCGCTAGCGCAACGA
Roseiflexus castenholzii DSM 13941
	Rcas_3898	Rcas_3898	-111	6.5	AACTTGCGCCAGCGCAACGA
Roseiflexus sp. RS-1
	RoseRS_0596	Rcas_3898	-105	6.5	AACTTGCGCCAGCGCAACGA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD