Regulon of YbzH in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_018560
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Metabolite transport
Effector:
Regulog:	YbzH - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - ArsR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6.2 Sequence: ATATCGATATATCACAATAT Locus tag: RBAM_018550 Name: ybcL Funciton: Putative efflux transporter
	RBAM_018550	ybcL	Putative efflux transporter
Position: -30 Score: 6.4 Sequence: ATATCGTAAAATCACGATAT Locus tag: RBAM_018560 Name: ybzH Funciton: Transcriptional regulator, ArsR family
	RBAM_018560	ybzH	Transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD