Regulog YbzH - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - ArsR
- By pathway - Metabolite transport
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 2 | 2 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 2 | 2 |
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | 2 | 2 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 2 |
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ybzH |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -30 score = 6.4094 sequence = ATATCGTAAAATCACGATAT Gene: RBAM_018560: Transcriptional regulator, ArsR family |
|
*
Bacillus clausii KSM-K16 Site: position = -30 score = 5.54045 sequence = ATATCGCAAAATGTAGATAT Gene: ABC1381: Transcriptional regulator, ArsR family |
|
*
Bacillus licheniformis DSM 13 Site: position = -29 score = 6.14853 sequence = ATATTGACAATTTTCGATAT Gene: BLi00209: Transcriptional regulator, ArsR family |
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -30 score = 6.64061 sequence = ATATCGAAATATAACGATAT Gene: BSU01889: Transcriptional regulator, ArsR family |
|
|
|
Transcriptional regulator, ArsR family |
| CRON 2. | ||||||||||||
| ybcL |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -56 score = 6.24823 sequence = ATATCGATATATCACAATAT Gene: RBAM_018550: Putative efflux transporter |
|
*
Bacillus clausii KSM-K16 Site: position = -75 score = 5.88857 sequence = ACATCGACATATCGCGATAT Gene: ABC1382: Putative efflux transporter |
|
*
Bacillus licheniformis DSM 13 Site: position = -93 score = 6.50132 sequence = ATATCGACATATTTCGATGT Gene: BLi00210: Putative efflux transporter |
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -90 score = 6.44651 sequence = ATATCGACATATTACGATGT Gene: BSU01890: Putative efflux transporter |
|
|
|
Putative efflux transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |