Regulon of UxuR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_0332
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucuronate utilization
Effector:	Aldotetraouronic acid
Regulog:	UxuR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Aldotetraouronic acid
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 4.7 Sequence: CAAGAATACAAGTAAAGTAA Locus tag: Pjdr2_0332 Name: uxuR Funciton: Transcriptional regulator of glucuronate utilization, GntR family Locus tag: Pjdr2_0333 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: Pjdr2_0334 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	Pjdr2_0332	uxuR	Transcriptional regulator of glucuronate utilization, GntR family
	Pjdr2_0333	uxuA	Mannonate dehydratase (EC 4.2.1.8)
	Pjdr2_0334	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD