Regulon of UxuR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1062
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucuronate utilization
Effector:	Aldotetraouronic acid
Regulog:	UxuR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Aldotetraouronic acid
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 6.1 Sequence: CTACCATACTAGTATGATTA Locus tag: BH1064 Name: BH1064 Funciton: Putative aldotetraouronic acid ABC transporter, substrate-binding protein Locus tag: BH1065 Name: BH1065 Funciton: Putative aldotetraouronic acid ABC transporter, permease component Locus tag: BH1066 Name: BH1066 Funciton: Putative aldotetraouronic acid ABC transporter, permease component Locus tag: BH1067 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: BH1068 Name: xynB Funciton: Beta-xylosidase
	BH1064	BH1064	Putative aldotetraouronic acid ABC transporter, substrate-binding protein
	BH1065	BH1065	Putative aldotetraouronic acid ABC transporter, permease component
	BH1066	BH1066	Putative aldotetraouronic acid ABC transporter, permease component
	BH1067	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
	BH1068	xynB	Beta-xylosidase
Position: -45 Score: 5.6 Sequence: TATGTATACTAGTATGGTTA Locus tag: BH1063 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8)
	BH1063	uxuA	Mannonate dehydratase (EC 4.2.1.8)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD