Regulon of UxuR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC0604, ABC4047
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucuronate utilization
Effector:	Aldotetraouronic acid
Regulog:	UxuR - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Aldotetraouronic acid
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -146 Score: 6 Sequence: CTACCACACTTGTATGGTAG Locus tag: ABC0630 Name: uxmD Funciton: Predicted mannuronate dehydrogenase (EC 1.1.1.131) Locus tag: ABC0631 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: ABC0632 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	ABC0630	uxmD	Predicted mannuronate dehydrogenase (EC 1.1.1.131)
	ABC0631	uxuA	Mannonate dehydratase (EC 4.2.1.8)
	ABC0632	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
Position: -62 Score: 5.8 Sequence: CTACCATATTTGTATGGTAG Locus tag: ABC4047 Name: uxuR2 Funciton: Transcriptional regulator of glucuronate utilization, GntR family Locus tag: ABC4046 Name: uxuP2 Funciton: Predicted glucuronate TRAP-type transporter, periplasmic component Locus tag: ABC4045 Name: uxuQ2 Funciton: Predicted glucuronate TRAP-type transporter, small permease component Locus tag: ABC4044 Name: uxuM2 Funciton: Predicted glucuronate TRAP-type transporter, large permease component
	ABC4047	uxuR2	Transcriptional regulator of glucuronate utilization, GntR family
	ABC4046	uxuP2	Predicted glucuronate TRAP-type transporter, periplasmic component
	ABC4045	uxuQ2	Predicted glucuronate TRAP-type transporter, small permease component
	ABC4044	uxuM2	Predicted glucuronate TRAP-type transporter, large permease component
Position: -31 Score: 5.4 Sequence: CTACCATACTAGTATAAGTA Locus tag: ABC0604 Name: uxuR Funciton: Transcriptional regulator of glucuronate utilization, GntR family
	ABC0604	uxuR	Transcriptional regulator of glucuronate utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD