Regulon of GutR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_006530
Regulator family:	GutR
Regulation mode:	activator
Biological process:	Sorbitol utilization
Effector:	Sorbitol
Regulog:	GutR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GutR
By effector - Sorbitol
By pathway - Sorbitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 6.8 Sequence: ATAAAAGGACAGCCGCACTGTACTTTTTA Locus tag: RBAM_006530 Name: gutR Funciton: Transcriptional regulator of the sorbitol operon
	RBAM_006530	gutR	Transcriptional regulator of the sorbitol operon
Position: -140 Score: 6.8 Sequence: TAAAAAGTACAGTGCGGCTGTCCTTTTAT Locus tag: RBAM_006540 Name: gutB Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: RBAM_006550 Name: gutA Funciton: Glucitol/sorbitol-specific transport protein
	RBAM_006540	gutB	Sorbitol dehydrogenase (EC 1.1.1.14)
	RBAM_006550	gutA	Glucitol/sorbitol-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD