Regulog GutR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GutR |
| Regulation mode: | activator |
| Biological process: | Sorbitol utilization |
| Effector: | Sorbitol |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GutR
- By effector - Sorbitol
- By pathway - Sorbitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 3 | 2 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | 3 | 2 |
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| gutB |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -140 score = 6.79702 sequence = TAAAAAGTACAGTGCGGCTGTCCTTTTAT Gene: RBAM_006540: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -142 score = 7.34577 sequence = ATAAAAGTACAGTGCCGCTGTCCTTTTAT Gene: BSU06150: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
|
|
Sorbitol dehydrogenase (EC 1.1.1.14) |
| gutA |
|
Gene: RBAM_006550: Glucitol/sorbitol-specific transport protein |
|
|
|
|
|
Gene: BSU06160: Glucitol/sorbitol-specific transport protein |
|
|
|
Glucitol/sorbitol-specific transport protein |
| CRON 2. | ||||||||||||
| gutR |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -89 score = 6.79702 sequence = ATAAAAGGACAGCCGCACTGTACTTTTTA Gene: RBAM_006530: Transcriptional regulator of the sorbitol operon |
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -88 score = 7.34577 sequence = ATAAAAGGACAGCGGCACTGTACTTTTAT Gene: BSU06140: Transcriptional regulator of the sorbitol operon |
|
|
|
Transcriptional regulator of the sorbitol operon |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |