Regulon of MurR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_1243
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Regulog:	MurR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - RpiR
By effector - N-acetylmuramate-6-phosphate
By pathway - N-acetylmuramate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 6.6 Sequence: AAACGAAATAATATTTCTTAA Position: -71 Score: 6.6 Sequence: GCTTGAAATAATAATTCGTTT Locus tag: LACR_1240 Name: murX Funciton: Predicted outer membrane protein Locus tag: LACR_1241 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: LACR_1242 Name: murP Funciton: MurNAc-specific PTS system, EIIBC component Locus tag: LACR_1243 Name: murR Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
	LACR_1240	murX	Predicted outer membrane protein
	LACR_1241	murQ	N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
	LACR_1242	murP	MurNAc-specific PTS system, EIIBC component
	LACR_1243	murR	N-acetylmuramate utilization transcriptional regulator MurR, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD