Regulog MurR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | repressor |
| Biological process: | N-acetylmuramate utilization |
| Effector: | N-acetylmuramate-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - RpiR
- By effector - N-acetylmuramate-6-phosphate
- By pathway - N-acetylmuramate utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 4 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | 5 | 1 |
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| murX |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -111 score = 6.60059 sequence = AAACGAAATAATATTTCTTAA Site: position = -71 score = 6.55814 sequence = GCTTGAAATAATAATTCGTTT Gene: LACR_1240: Predicted outer membrane protein |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -71 score = 6.78934 sequence = ACTTGAAATAATAATTCTTTT Site: position = -112 score = 6.36939 sequence = CAATGAAATAATATTTCAAAA Gene: L143292: Predicted outer membrane protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Predicted outer membrane protein |
| murQ |
Gene: LACR_1241: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) |
Gene: L144334: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) |
|
|
|
|
|
|
|
|
|
|
|
|
|
N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) |
| murP |
Gene: LACR_1242: MurNAc-specific PTS system, EIIBC component |
2
Lactococcus lactis subsp. lactis Il1403 Gene: L146642: MurNAc-specific PTS system, EIIBC component Gene: L145238: MurNAc-specific PTS system, EIIBC component |
|
|
|
|
|
|
|
|
|
|
|
|
|
MurNAc-specific PTS system, EIIBC component |
| murR |
Gene: LACR_1243: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family |
Gene: L147291: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family |
|
|
|
|
|
|
|
|
|
|
|
|
|
N-acetylmuramate utilization transcriptional regulator MurR, RpiR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |