Regulon of ScrR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str1737, str1736
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6.2 Sequence: TATGTCAAACGTTTAGCATT Position: -52 Score: 5.2 Sequence: TAGGTAAAACGTTTACTATA Locus tag: str1735 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: str1736 Name: scrR Funciton: Sucrose utilization regulator ScrR, LacI family Locus tag: str1737 Name: scrR Funciton: Sucrose utilization regulator ScrR, LacI family
	str1735	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	str1736	scrR	Sucrose utilization regulator ScrR, LacI family
	str1737	scrR	Sucrose utilization regulator ScrR, LacI family
Position: -156 Score: 6.1 Sequence: AATGCTAAACGTTTGACATA Locus tag: str1734 Name: scrA Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) Locus tag: str1733 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	str1734	scrA	Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
	str1733	scrK	Fructokinase (EC 2.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD