Regulon of ScrR in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy1817
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6.1 Sequence: TATGTCAAGCGCCTAACATA Locus tag: SPy1816 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: SPy1817 Name: scrR Funciton: Sucrose utilization regulator ScrR, LacI family
	SPy1816	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	SPy1817	scrR	Sucrose utilization regulator ScrR, LacI family
Position: -152 Score: 6.2 Sequence: TATGTTAGGCGCTTGACATA Locus tag: SPy1815 Name: scrA Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
	SPy1815	scrA	Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD