Regulon of MalR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB0235, SUB1142
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.4 Sequence: AAACGCAAACGTTTGCGTAA Locus tag: SUB0236 Name: ptsG Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69) Locus tag: SUB0237 Name: rgfB Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
	SUB0236	ptsG	PTS system glucose-specific EIICBA component (EC 2.7.1.69)
	SUB0237	rgfB	Exodeoxyribonuclease III (EC 3.1.11.2)
Position: -161 Score: 6 Sequence: TTATGCAACCGTTTGCAGAA Locus tag: SUB1142 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family
	SUB1142	malR	Maltose utilization transcriptional regulator MalR, LacI family
Position: -56 Score: 6.4 Sequence: TTACGCAAACGGTTGCGTTA Locus tag: SUB1141 Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: SUB1140 Name: malP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	SUB1141	malM	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	SUB1140	malP	Maltodextrin phosphorylase (EC 2.4.1.1)
Position: -55 Score: 6.2 Sequence: TTCTGCAAACGGTTGCATAA Locus tag: SUB1143 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SUB1144 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SUB1145 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	SUB1143	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	SUB1144	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	SUB1145	malG	Maltose/maltodextrin ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD