Regulon of MalR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str1014
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 5.3 Sequence: TTATGAAACCGTTATCATAA Locus tag: str1014 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family
	str1014	malR	Maltose utilization transcriptional regulator MalR, LacI family
Position: -57 Score: 5.6 Sequence: ACGTGCAACCGTTTGCATTA Locus tag: str1013 Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: str1012 Name: malP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	str1013	malM	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	str1012	malP	Maltodextrin phosphorylase (EC 2.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD