Regulon of MalR in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.1566
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.1 Sequence: AAATGCAAACGTTTGCATGA Locus tag: SMU.2047 Name: ptsG Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69) Locus tag: SMU.2046c Name: rgfB Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
	SMU.2047	ptsG	PTS system glucose-specific EIICBA component (EC 2.7.1.69)
	SMU.2046c	rgfB	Exodeoxyribonuclease III (EC 3.1.11.2)
Position: -200 Score: 5.8 Sequence: TTATGCAATCGTTTGCGAAA Locus tag: SMU.1566 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family
	SMU.1566	malR	Maltose utilization transcriptional regulator MalR, LacI family
Position: -61 Score: 6.4 Sequence: TTATGCAAACGATTGCGTTA Locus tag: SMU.1565 Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: SMU.1564 Name: malP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	SMU.1565	malM	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	SMU.1564	malP	Maltodextrin phosphorylase (EC 2.4.1.1)
Position: -66 Score: 6 Sequence: TTTCGCAAACGATTGCATAA Locus tag: SMU.1568 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SMU.1569 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SMU.1570 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	SMU.1568	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	SMU.1569	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	SMU.1570	malG	Maltose/maltodextrin ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD